Cloning and sequencing of a beta-lactamase-encoding gene from the insect pathogen Bacillus thuringiensis.
A beta-lactamase (Bla)-encoding gene (bla) from Bacillus thuringiensis (Bt) was cloned and the nucleotide (nt) sequence was determined. Both the nt sequence and deduced amino acid sequences reveal that the Bt Bla is very similar to that of B. cereus and other group A Bla. The transcription start point was also determined. Comparison of the upstream region of Bt bla with that of other genes suggested the presence of three sequence elements that might be involved in promoter function: the -10 (TCGGTGAT) and -35 (TTAT) sequences, an A+T-rich region (5'TACTAGCTATAATTTTTTAGT) and an inverted repeat sequence (5'-GAGATAGAGGC[GCTACTATCTC).
Gene 158:83-86(1995) [ PubMed | SRS | CiteXplore ]



